Charis Amarantini and Tri Yahya Budiarso and Vincent Santosa (2024) DETECTION OF INVA GENE AND ANTIBIOTIC SUSCEPTIBILITY PATTERN OF INDIGENOUS SALMONELLA TYPHI ISOLATES. African Journal of Biological Sciences, 6 (13). pp. 2632-2644. ISSN 2663-2187
Text (Artikel Jurnal)
Detection of InvA Gene and Antibiotic Susceptibility Pattern.pdf - Published Version Download (480kB) |
Abstract
The invA gene is a virulence factor in Salmonella typhi bacteria that can cause the bacteria to invade intestinal epithelial cells and produce toxic compounds that are pathogenic. The invA gene is also known to be resistant to certain antibiotics. This study was conducted to determine the profile of antibiotic resistance from collection of S. typhi isolates that were detected to have the invA gene. Antibiotic resistance was tested using the Kirby-Bauer method. Meanwhile, the invA gene (284 bp) was detected using the primers IAF (5' GTGAAATTATCGCCACGTTCGGGCAA 3') and IAR (5'TCATCGCACCGTCAAAGGACCC 3'). The antibiotic resistance of S. typhi isolates to the ten types of antibiotics was very diverse. Two of the 14 isolates tested, namely S. typhi BPE 121.1MC and BPE 122.4CCA were known to have the highest Multiple Antimicrobial Resistance Index. Imipenem and piperacillin were the most effective antibiotics with an inhibition zone of ≥22 mm. Meanwhile, ceftazidime is classified as the least effective antibiotic for inhibiting S. typhi. Most of the isolates tested were multidrug resistant. The invA gene was detected in all tested isolates. Based on the results, caution is needed in the use of antibiotics because they have begun to show a decrease in effectiveness.
Item Type: | Article |
---|---|
Uncontrolled Keywords: | antibiotic resistance, invA gene, Salmonella typhi. |
Subjects: | Q Ilmu Pengetahuan > QH Sejarah Alam > QH301 Biologi |
Divisions: | Fakultas Bioteknologi |
Depositing User: | Beatrix Stefany |
Date Deposited: | 25 Sep 2024 01:43 |
Last Modified: | 25 Sep 2024 01:43 |
URI: | http://katalog.ukdw.ac.id/id/eprint/9405 |
Actions (login required)
View Item |