eprintid: 9405
rev_number: 11
eprint_status: archive
userid: 2098
dir: disk0/00/00/94/05
datestamp: 2024-09-25 01:43:24
lastmod: 2024-09-25 01:43:24
status_changed: 2024-09-25 01:43:24
type: article
metadata_visibility: show
contact_email: repository@staff.ukdw.ac.id
creators_name: , Charis Amarantini
creators_name: , Tri Yahya Budiarso
creators_name: , Vincent Santosa
creators_id: 0519016801
creators_id: 0503036902
creators_id: 31190293
title: DETECTION OF INVA GENE AND ANTIBIOTIC SUSCEPTIBILITY PATTERN OF INDIGENOUS SALMONELLA TYPHI ISOLATES
ispublished: pub
subjects: QH301
divisions: fak_biot
full_text_status: public
keywords: antibiotic resistance, invA gene, Salmonella typhi.
abstract: The invA gene is a virulence factor in Salmonella typhi bacteria that can cause the bacteria to invade intestinal epithelial cells and produce toxic compounds that are pathogenic. The invA gene is also known to be resistant to certain antibiotics. This study was conducted to determine the profile of antibiotic resistance from collection of S. typhi isolates that were detected to have the invA gene. Antibiotic resistance was tested using the Kirby-Bauer method. Meanwhile, the invA gene (284 bp) was detected using the primers IAF (5' GTGAAATTATCGCCACGTTCGGGCAA 3') and IAR (5'TCATCGCACCGTCAAAGGACCC 3'). The antibiotic resistance of S. typhi isolates to the ten types of antibiotics was very diverse. Two of the 14 isolates tested, namely S. typhi BPE 121.1MC and BPE 122.4CCA were known to have the highest Multiple Antimicrobial Resistance Index. Imipenem and piperacillin were the most effective antibiotics with an inhibition zone of ≥22 mm. Meanwhile, ceftazidime is classified as the least effective antibiotic for inhibiting S. typhi. Most of the isolates tested were multidrug resistant. The invA gene was detected in all tested isolates. Based on the results, caution is needed in the use of antibiotics because they have begun to show a decrease in effectiveness.
date: 2024
publication: African Journal of Biological Sciences
volume: 6
number: 13
publisher: INSTITUTE FOR ADVANCED STUDIES the publisher of the open access journal African Journal of Biological Sciences (South Africa)
pagerange: 2632-2644
id_number: doi:10.48047/AFJBS.6.13.2024. 2632-2644
refereed: TRUE
issn: 2663-2187
official_url: https://www.afjbs.com/uploads/paper/1217fee1c3033d2fb317ecde5f6959f0.pdf
funders: charis@staff.ukdw.ac.id
citation:   Charis Amarantini and Tri Yahya Budiarso and Vincent Santosa  (2024) DETECTION OF INVA GENE AND ANTIBIOTIC SUSCEPTIBILITY PATTERN OF INDIGENOUS SALMONELLA TYPHI ISOLATES.  African Journal of Biological Sciences, 6 (13).  pp. 2632-2644.  ISSN 2663-2187     
document_url: https://katalog.ukdw.ac.id/9405/1/Detection%20of%20InvA%20Gene%20and%20Antibiotic%20Susceptibility%20Pattern.pdf